java project - need a fully experienced java freelancer

Preklicano Objavljeno pred 4 letoma/leti Plačilo ob prevzemu
Preklicano Plačilo ob prevzemu

need a java freelancer, who is an expert with java to solve three challenges, they are basic java coding challenges need to be done asap by a professional freelancer, should be done asap within 10-15 mins

here is challenges:

first:

* Within this Calculator class you will need to create 4 methods.

* The four methods will relate to the basic functions of a calculator and should be named:

* <p>

* - add

* - subtract

* - multiply

* - divide

* <p>

* Each method accept 'int' two numbers and return the int value.

* <p>

* Don't forget to look at the tests for guidance.

second:

* A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

*

* An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."

*

* Given: A DNA string s of length at most 1000 nt.

*

* Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.

*

* Sample Dataset

* AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

*

* Sample Output

* 20 12 17 21

*

*/

/**

* The Challenge

*

* You will need to implement the counters as per the name in names in the return statement.

* You will then need to create a loop to parse each Char within the string and count them

* by passing the values to counters.

third

Java JavaScript JavaFX

ID projekta: #20907151

Več o projektu

7 predlogov Oddaljen projekt Aktiven pred 4 letoma/leti

7 freelancerjev ponuja v povprečju za £152 na tem delu

iridescent2x15

HI I am software engineer and have done many java and technical projects. You can discuss more details with me so that we can negotiate the price accordingly. Thank you

£150 GBP v 7 dneh
(67 ocen)
6.1
CliveLewis

Hello! :) I checked the description of your project and can tell that these tasks are very simple and I can complete them right now. I work as a Java developer full-time, so trust me, this "project" will be done in no Več

£30 GBP v 1 dnevu
(5 ocen)
3.2
Mexi2705

Hello I am having 10+ years of experience in development in same field. https://www.freelancer.in/u/Mexi2705/ you can go with my profile. I am full time freelancer. Let's connect and discuss in details. Thank you

£500 GBP v 7 dneh
(2 ocen)
0.0
pynki

HI, lets have a chat about the specifications of the task. 1. will not work without clarification - the division might produce something else than an int. About 3. we also should talk before starting this job. Cheer Več

£80 GBP v 1 dnevu
(0 ocen)
0.0
shethap

Hi, I have 10 years of rich experience in nava & I am working as a freelancer. I can assist you that I will not charge reasonably good with better quality output.

£20 GBP v 1 dnevu
(0 ocen)
0.0